The Fistula Risk Score Catalog: Toward Precision Medicine for Pancreatic Fistula After Pancreatoduodenectomy

Objective: The aim of this study to present a full spectrum of individual presentations of pancreatic fistula risk patients, and to determine the utility of mitigation strategies among some of the most common and vulnerable scenario surgeon meeting.

Background: FRS has been used to identify technical strategies related to reducing the incidence of CR-POPF in various strata of risk. However, risk-stratification using the FRS not been investigated with greater granularity. By lowering all possible combinations of elements FRS, individual risk assessment can be used for medicinal purposes precision.

Methods: FRS profile and the results of the 5533 PD accrued from 17 international organizations (2003-2019). FRS is used to get 80 patients a unique combination of a “scenario.” risk-matched analysis was performed using a Bonferroni adjustment to identify the scenario with increased susceptibility to CR-POPF occurrence. Furthermore, these scenarios were analyzed using multivariable regression to explore the optimal mitigation approach.

Results: The overall rate of CR-POPF was 13.6%. All 80 scenarios that may be encountered, with the most frequent being the scenario # 1 (8.1%) – only negligible-risk scenario (level CR-POPF = 0.7%). Moderate-risk zone has the most scenario (50), patients (N = 3246), CR-POPFs (65.2%), and the largest non-zero-POPF CR rate differences between the scenarios (18-fold). In a risk-matched analysis, scenario 2 (# 59 and 60) displayed increased susceptibility to CR-POPF relative to moderate-risk zones (both P <0.001). Multivariate analysis revealed that factors associated with CR-POPF in this scenario: pancreaticogastrostomy reconstruction [odds ratio (OR) 4.67], negligence drain placement (OR 5.51), and octreotide prophylaxis (OR 3.09).

When comparing the utilization of best practice strategies for patients who do not have these jointly exploited, there is a significant reduction in CR-POPF (10.7% vs 35.5%, P <0.001; OR 0.20, 95% confidence interval 0, 12-.33).
Conclusion: Through this data, the risk of fistula comprehensive catalog has been created and the most clinical scenario-impact has been seen. Focusing on individual scenario provides a practical way for the treatment of precision approach, allowing for more focused management and efficient CR-POPF.

 The Fistula Risk Score Catalog: Toward Precision Medicine for Pancreatic Fistula After Pancreatoduodenectomy
The Fistula Risk Score Catalog: Toward Precision Medicine for Pancreatic Fistula After Pancreatoduodenectomy

The Gene Catalog Gut Microbiome and Comparative Analysis of Big Cats Gives New Insights in Panthera Species

Most of metagenomic research in the past decade have focused on expressing the human gut microbiomes, rodents and ruminants; However, the gut microbiome and genic information (catalog of genes) of felids such large Panthera species are largely unknown until now. In this study, the intestinal bacterial, fungal, and viral metagenomic rated composition of three species of Panthera (lions, leopards, and tigers) from India, which consume the same diet and belong to the same geographical location.

A catalog of non-redundant bacterial genes of Panthera intestine consists of 1,507,035 putative gene constructed of 27 individual Panthera, which revealed a higher abundance of purine metabolism genes associated with their dietary intake of purine-rich. Analysis of Carbohydrate Active enzyme (CAZy) and database enrichment Merops identified glycoside hydrolase (GHs), glycosides-transferase, and collagenase in the intestines, which is essential for the absorption of nutrients from animal biomass. Bacteria, fungi, and viruses community analysis provides first comprehensive insight into specific Panthera microbial communities.

Human TET3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse TET3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
pROKII- RNAI Plasmid
PVT3202 2 ug
EUR 266.00
Tet3 sgRNA CRISPR Lentivector set (Mouse)
K5028101 3 x 1.0 ug
EUR 339.00
TET3 sgRNA CRISPR Lentivector set (Human)
K2358901 3 x 1.0 ug
EUR 339.00
GeneGlide? RNAi Delivery Control
EUR 237.00
GeneGlide? RNAi Delivery Control
EUR 835.00
GeneGlide? RNAi Delivery Control
EUR 495.00
T7 RNAi Transcription Kit
TR102-01 25 rxn
EUR 256.00
T7 RNAi Transcription Kit
TR102-02 50 rxn
EUR 404.00
Methylcytosine Dioxygenase TET3 (TET3) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
Methylcytosine Dioxygenase TET3 (TET3) Antibody
abx340219-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.
Methylcytosine Dioxygenase TET3 (TET3) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
Methylcytosine Dioxygenase TET3 (TET3) Antibody
abx002256-200ul 200 ul
EUR 411.00
  • Shipped within 5-10 working days.
Methylcytosine Dioxygenase TET3 (TET3) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
Methylcytosine Dioxygenase TET3 (TET3) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
Methylcytosine Dioxygenase TET3 (TET3) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
TET3 Antibody
25532-100ul 100ul
EUR 390.00
TET3 Antibody
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TET3. Recognizes TET3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
YF-PA22679 50 ug
EUR 363.00
Description: Mouse polyclonal to TET3
Mouse Methylcytosine dioxygenase TET3, Tet3 ELISA KIT
ELI-18971m 96 Tests
EUR 865.00
Human Methylcytosine dioxygenase TET3, TET3 ELISA KIT
ELI-52091h 96 Tests
EUR 824.00
TET3 Polyclonal Antibody
30984-100ul 100ul
EUR 252.00
TET3 Polyclonal Antibody
30984-50ul 50ul
EUR 187.00
TET3 Polyclonal Antibody
30014-100ul 100ul
EUR 252.00
TET3 Polyclonal Antibody
30014-50ul 50ul
EUR 187.00
TET3 Polyclonal Antibody
28303-100ul 100ul
EUR 252.00
TET3 Polyclonal Antibody
28303-50ul 50ul
EUR 187.00
TET3 Rabbit pAb
A13453-100ul 100 ul
EUR 308.00
TET3 Rabbit pAb
A13453-200ul 200 ul
EUR 459.00
TET3 Rabbit pAb
A13453-20ul 20 ul
EUR 183.00
TET3 Rabbit pAb
A13453-50ul 50 ul
EUR 223.00
TET3 cloning plasmid
CSB-CL023398HU-10ug 10ug
EUR 558.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2814
  • Sequence: atggaggagcggtatggagagaaggggaaagccatccggatcgagaaggtcatctacacggggaaggagggaaagagctcccgcggttgccccattgcaaagtgggtgatccgcaggcacacgctggaggagaagctactctgcctggtgcggcaccgggcaggccaccactgcc
  • Show more
Description: A cloning plasmid for the TET3 gene.
TET3 Rabbit pAb
A7612-100ul 100 ul
EUR 308.00
TET3 Rabbit pAb
A7612-200ul 200 ul
EUR 459.00
TET3 Rabbit pAb
A7612-20ul 20 ul
EUR 183.00
TET3 Rabbit pAb
A7612-50ul 50 ul
EUR 223.00
TET3 Rabbit pAb
A3141-100ul 100 ul Ask for price
TET3 Rabbit pAb
A3141-200ul 200 ul
EUR 308.00
TET3 Rabbit pAb
A3141-20ul 20 ul Ask for price
TET3 Rabbit pAb
A3141-50ul 50 ul Ask for price
TET3 Polyclonal Antibody
A50520 100 µg
EUR 570.55
Description: fast delivery possible
TET3 Rabbit pAb
A18319-100ul 100 ul
EUR 308.00
TET3 Rabbit pAb
A18319-200ul 200 ul
EUR 459.00
TET3 Rabbit pAb
A18319-20ul 20 ul
EUR 183.00
TET3 Rabbit pAb
A18319-50ul 50 ul
EUR 223.00
TET3 Rabbit pAb
A17310-100ul 100 ul
EUR 308.00
TET3 Rabbit pAb
A17310-200ul 200 ul
EUR 459.00
TET3 Rabbit pAb
A17310-20ul 20 ul
EUR 183.00
TET3 Rabbit pAb
A17310-50ul 50 ul
EUR 223.00
PVT14083 2 ug
EUR 391.00
Anti-TET3 antibody
STJ11100275 100 µl
EUR 277.00
Anti-TET3 antibody
STJ11100897 200 µl
EUR 277.00
Description: NA
Anti-TET3 antibody
STJ115414 100 µl
EUR 277.00
Anti-TET3 antibody
STJ119440 100 µl
EUR 277.00
Anti-TET3 antibody
STJ29749 100 µl
EUR 277.00
Set of 10 Biolipidure Reagents
Biolipidure-set 10mLx10
EUR 1517.00
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: Set of 10 Biolipidure Reagents, whose applications include Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement
Tet3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K5028105 3 x 1.0 ug
EUR 376.00
TET3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2358905 3 x 1.0 ug
EUR 376.00
StemBoost? YPAC Cocktail Set (1000X), Sterile-Filtered
EUR 958.00
pAd/BLOCK-iT-DEST RNAi Gateway Vector
PVT12297 2 ug
EUR 1119.00
StemBoost? Reprogramming Cocktail Set I (1000X), Sterile-Filtered
EUR 849.00
StemBoost? Reprogramming Cocktail Set II (1000X), Sterile-Filtered
EUR 838.00
StemBoost? 2i-Reprogramming Cocktail Set (1000X), Sterile-Filtered
EUR 620.00
TET3 Polyclonal Conjugated Antibody
C28303 100ul
EUR 397.00
TET3 Polyclonal Conjugated Antibody
C30014 100ul
EUR 397.00
TET3 Polyclonal Conjugated Antibody
C30984 100ul
EUR 397.00
TET3 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TET3. Recognizes TET3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TET3 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TET3. Recognizes TET3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TET3 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TET3. Recognizes TET3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
StemBoost? SMAD Signaling Inhibitor Cocktail Set (1000X), Sterile-Filtered
EUR 512.00
StemBoost? Neuronal Cell Induction Cocktail Set (100X), Sterile-Filtered
EUR 805.00
Antigen-Antibody Pens, a set of any 3 pens
EUR 451.00
shRNA-H1 (Neg)-(blasticidin) lentivirus
H1(shRNA-Ctr)-Bsd 1 x107 IFU/ml x 200ul
EUR 349.00
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Blasticidin marker under Rsv promoter.
shRNA-H1 (Neg)-(Puromycin) lentivirus
H1(shRNA-Ctr)-Puro 1 x107 IFU/ml x 200ul
EUR 349.00
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Puromycin marker under Rsv promoter.
shRNA-U6 (Neg)-(blasticidin) lentivirus
U6(shRNA-Ctr)-Bsd 1 x107 IFU/ml x 200ul
EUR 349.00
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Blasticidin marker under Rsv promoter.
shRNA-U6 (Neg)-(Puromycin) lentivirus
U6(shRNA-Ctr)-Puro 1 x107 IFU/ml x 200ul
EUR 349.00
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Puromycin marker under Rsv promoter.
Tet3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K5028102 1.0 ug DNA
EUR 154.00
Tet3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K5028103 1.0 ug DNA
EUR 154.00
Tet3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K5028104 1.0 ug DNA
EUR 154.00
TET3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2358902 1.0 ug DNA
EUR 154.00
TET3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2358903 1.0 ug DNA
EUR 154.00
TET3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2358904 1.0 ug DNA
EUR 154.00
shRNA-H1 (Neg)-( GFP-Bsd) lentivirus
H1(shRNA-Ctr)-GB 1 x107 IFU/ml x 200ul
EUR 349.00
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Blasticidin fusion marker under Rsv promoter.
shRNA-H1 (Neg)-( GFP-Puro) lentivirus
H1(shRNA-Ctr)-GP 1 x107 IFU/ml x 200ul
EUR 349.00
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Puromycin fusion marker under Rsv promoter.
shRNA-H1 (Neg)-( RFP-Bsd) lentivirus
H1(shRNA-Ctr)-RB 1 x107 IFU/ml x 200ul
EUR 349.00
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-Blasticidin fusion marker under Rsv promoter.
shRNA-H1(Neg)-( RFP-Puro) lentivirus
H1(shRNA-Ctr)-RP 1 x107 IFU/ml x 200ul
EUR 349.00
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-puromycin fusion marker under Rsv promoter.
shRNA-U6 (Neg)-( GFP-Bsd) lentivirus
U6(shRNA-Ctr)-GB 1 x107 IFU/ml x 200ul
EUR 349.00
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Blasticidin fusion marker under Rsv promoter.
shRNA-U6 (Neg)-( GFP-Puro) lentivirus
U6(shRNA-Ctr)-GP 1 x107 IFU/ml x 200ul
EUR 349.00
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Puromycin fusion marker under Rsv promoter.
shRNA-U6 (Neg)-( RFP-Bsd) lentivirus
U6(shRNA-Ctr)-RB 1 x107 IFU/ml x 200ul
EUR 349.00
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-Blasticidin fusion marker under Rsv promoter.
shRNA-U6 (Neg)-( RFP-Puro) lentivirus
U6(shRNA-Ctr)-RP 1 x107 IFU/ml x 200ul
EUR 349.00
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-puromycin fusion marker under Rsv promoter.
Mouse IgA, IgGs (1, 2a, 2b, 3), IgM, and IgE isotype controls (set of 7 IgGs)
20102-SET 1 Set (100 ugx7)
EUR 598.00
TET3 Polyclonal Antibody, HRP Conjugated
A50521 100 µg
EUR 570.55
Description: reagents widely cited
TET3 Polyclonal Antibody, FITC Conjugated
A50522 100 µg
EUR 570.55
Description: Ask the seller for details
TET3 Polyclonal Antibody, Biotin Conjugated
A50523 100 µg
EUR 570.55
Description: The best epigenetics products
h TET3 inducible lentiviral particles
LVP876 1x107 IFU/ml x 200ul
EUR 451.00
Description: Pre-made over-expression lentivirus for expressing human target: TET3 (tet methylcytosine dioxygenase 3), [alternative names: hCG_40738]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_001287491.1 . It also contains a RFP-Blasticidin dual selection marker.
TET3 ORF Vector (Human) (pORF)
ORF010432 1.0 ug DNA
EUR 95.00
Tet3 ORF Vector (Mouse) (pORF)
ORF059409 1.0 ug DNA
EUR 1572.00
pECMV-Tet3-m-FLAG Plasmid
PVT15658 2 ug
EUR 325.00
TET3 ELISA Kit (Human) (OKEH08659)
OKEH08659 96 Wells
EUR 896.00
Description: Description of target: Members of the ten-eleven translocation (TET) gene family, including TET3, play a role in the DNA methylation process (Langemeijer et al., 2009 [PubMed 19923888]).[supplied by OMIM, Nov 2010];Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.34ng/mL
TET3 ELISA Kit (Mouse) (OKEH08660)
OKEH08660 96 Wells
EUR 896.00
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.159ng/mL
50ml TC Tubes, Conical, 440 units/box
04-5540150 440 units/box
EUR 71.00
GMP IL4, 50µg
04-GMP-HU-IL4-50UG 50µg
EUR 483.00
Description: Recombinant Human IL-4 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 130 amino acids and having a molecular mass of 15000 Dalton. The rHuIL-4 is purified by proprietary chromatographic techniques.
rHu IL 2 , 3MIU
04-RHIL2-02F01 1 vial
EUR 249.00
Description: Recombinant human interleukin-2 is a sterile protein product for injection. rHuIL-2 is produced by recombinant DNA technology using Yeast. It is a highly purified protein containing 133 amino acids, with cysteine mutated to alanine at 125 amino acid position, and has a molecular weight of approximately 15.4kD, non-glycosylated.
rHu IL 2 , 3MIU , Lot 200908F02
04-RHIL2-08F02 1 vial
EUR 249.00
Description: Recombinant human interleukin-2 is a sterile protein product for injection. rHuIL-2 is produced by recombinant DNA technology using Yeast. It is a highly purified protein containing 133 amino acids, with cysteine mutated to alanine at 125 amino acid position, and has a molecular weight of approximately 15.4kD, non-glycosylated.
PRE-GMP rHu GM-CSF, Molgramostim-Leukoma
04-RHUGM-CSF-7A10 300 µg
EUR 385.00
Description: Recombinant human GM-CSF produced in E.coli is a single, non-glycosylated, polypeptide chain containing 127 amino acids, two pairs of disulfide bonds and having a molecular mass of approximately 14.5kD.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
shRNA-H1 (Neg)-( GFP-Bsd) lentivirus in PBS
H1(shRNA-Ctr)-GB-PBS 5 x107 IFU/ml x 200ul
EUR 710.00
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Blasticidin fusion marker under Rsv promoter. Virus was concentrated and provided in PBS solution.
shRNA-H1 (Neg)-( GFP-Puro) lentivirus in PBS
H1(shRNA-Ctr)-GP-PBS 5 x107 IFU/ml x 200ul
EUR 710.00
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Puromycin fusion marker under Rsv promoter. Virus was concentrated and provided in PBS solution.
shRNA-H1 (Neg)-( RFP-Bsd) lentivirus in PBS
H1(shRNA-Ctr)-RB-PBS 5 x107 IFU/ml x 200ul
EUR 710.00
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-Blasticidin fusion marker under Rsv promoter. Virus was concentrated and provided in PBS solution.
shRNA-H1(Neg)-( RFP-Puro) lentivirus in PBS
H1(shRNA-Ctr)-RP-PBS 5 x107 IFU/ml x 200ul
EUR 710.00
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-puromycin fusion marker under Rsv promoter. Virus was concentrated and provided in PBS solution.
TET3 Protein Vector (Human) (pPB-C-His)
PV041725 500 ng
EUR 329.00
TET3 Protein Vector (Human) (pPB-N-His)
PV041726 500 ng
EUR 329.00
TET3 Protein Vector (Human) (pPM-C-HA)
PV041727 500 ng
EUR 329.00
TET3 Protein Vector (Human) (pPM-C-His)
PV041728 500 ng
EUR 329.00
TET3 Protein Vector (Mouse) (pPB-C-His)
PV237634 500 ng
EUR 2794.00
TET3 Protein Vector (Mouse) (pPB-N-His)
PV237635 500 ng
EUR 2794.00
TET3 Protein Vector (Mouse) (pPM-C-HA)
PV237636 500 ng
EUR 2794.00
TET3 Protein Vector (Mouse) (pPM-C-His)
PV237637 500 ng
EUR 2794.00
Tet3 3'UTR Luciferase Stable Cell Line
TU120374 1.0 ml Ask for price
Tet3 3'UTR GFP Stable Cell Line
TU170374 1.0 ml Ask for price
Tet3 3'UTR Luciferase Stable Cell Line
TU221779 1.0 ml Ask for price
TET3 3'UTR GFP Stable Cell Line
TU075426 1.0 ml
EUR 2277.00
Tet3 3'UTR GFP Stable Cell Line
TU271779 1.0 ml Ask for price
TET3 3'UTR Luciferase Stable Cell Line
TU025426 1.0 ml
EUR 2277.00
ELISA Microplate Washer Automated (#MPW-30) bottle set (3 bottles and cap assembly)
MPW-30-SET 1
EUR 408.00
Tet3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K5028106 1.0 ug DNA
EUR 167.00
Tet3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K5028107 1.0 ug DNA
EUR 167.00
Tet3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K5028108 1.0 ug DNA
EUR 167.00

Panthera gene catalog and the largest comparative study of the composition of the gut bacteria of 68 individuals from carnivorous species from different geographic locations and diet underscores the role of diet and geography in shaping Panthera gut microbiome, which is significant for the health and conservation management of endangered species.